View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_high_20 (Length: 361)
Name: NF2683_high_20
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 97 - 330
Target Start/End: Complemental strand, 44552773 - 44552540
Alignment:
| Q |
97 |
tctccattttttcatcttatttcatctcttattgttcatcttgatgatcatgttcatcaatcttcttcaaagaaacccaggtaaaaacacttgcaccttc |
196 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
44552773 |
tctccattttttcatcttattccatctcttattgttcatcttgatgatcatgttcatcaatcttcttcaaagaaccccaggtaaaaacacttacaccttc |
44552674 |
T |
 |
| Q |
197 |
ttcgtaatttctttccacaacttatcacataagtttcaatttccttatcatttctttccacaactagccacaatcttatatcctcccttcctcacaaaat |
296 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44552673 |
ttcgtaatttatttccacaacttatcacataaggctcaatttccttatcatttctttccacaactacccacaatcttatatcctcccttcctcacaaaat |
44552574 |
T |
 |
| Q |
297 |
gcagccatcaataaactatagctaacaatccatt |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44552573 |
gcagccatcaataaactatagctaacaatccatt |
44552540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 37 - 82
Target Start/End: Complemental strand, 44552838 - 44552793
Alignment:
| Q |
37 |
gctagaaggagtattacccattgtgctaaccagtgaaccatccaca |
82 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
44552838 |
gctagaaggagcattacccattgtgctaactagtgaaccatccaca |
44552793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University