View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_high_38 (Length: 243)
Name: NF2683_high_38
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_high_38 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 141 - 243
Target Start/End: Complemental strand, 24769162 - 24769061
Alignment:
| Q |
141 |
gaagcatgcactggacaacttcctcttttcttgtacggcgctaaagcagtggacaaagttttgtgctgtgtttactgaaatgaaaaatactattttatcc |
240 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24769162 |
gaagcatgcactagacaacttcctcttttcttgtacggcgctaaagcagtggacaaagttttgtcctgtgttta-tgaaatgataaatactattttatcc |
24769064 |
T |
|
| Q |
241 |
ctt |
243 |
Q |
| |
|
||| |
|
|
| T |
24769063 |
ctt |
24769061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 11 - 101
Target Start/End: Complemental strand, 10240797 - 10240707
Alignment:
| Q |
11 |
gaagaaactacccaacaatgagaatgaacttcaagctacaaagaaacaactacccaaagtgcatattactaggagatggacgggagtttta |
101 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
10240797 |
gaagaaactactcaagaatgagaatgaacttcaacattcaaagaaacaactacccaaagtacatattactaggagatggactggagtttta |
10240707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University