View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_high_48 (Length: 224)
Name: NF2683_high_48
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 33709231 - 33709439
Alignment:
| Q |
1 |
gttatcatctcattccaccgccgcaccggagattcattccattgcattccgtggcatgatcttagcgccgctgttcttgattctgaaatatttatagctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33709231 |
gttatcatctcattccaccgccgcaccggagattcattccattgcattccgtggcatgatcttagcgccgctgttcttgattctgaaatatttatagctc |
33709330 |
T |
 |
| Q |
101 |
gctcgctcgctcaatgtctgccatggatttaatctggagagggaacgacaatgtggttccagacgcttctcatttctccgtcgcgatctacttcgctttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33709331 |
gctcgctcgctcaatgtctgccatggatttaatctggagagggaacgacaatgtggttccagacgcttctcatttctccgtcgcgatctacttcgctttt |
33709430 |
T |
 |
| Q |
201 |
ggtagtttg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
33709431 |
ggtagtttg |
33709439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University