View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_high_49 (Length: 206)
Name: NF2683_high_49
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_high_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 9611814 - 9611985
Alignment:
| Q |
19 |
gggttataatgggtgagaaaggtatgtaccattggtggttgaaaatatcttagtaatgaaaaacacatgggacaagccgtttgaagctggaatgcatttc |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9611814 |
gggttataatgggtgagaaaggtatttaccattggtggctgaaaatatcttagtaatgaaaaacacatgggacaagccgtttgaagctggaatgcatttc |
9611913 |
T |
|
| Q |
119 |
atcttctataaaaggttacaagaatacaaatttgtcttctatagttttagatttagattttccttaaccttt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9611914 |
atcttctataaaaggttacaagaatacaaatttgtcttctatagttttagatttagattttccttaaccttt |
9611985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University