View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_24 (Length: 340)
Name: NF2683_low_24
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 6461496 - 6461604
Alignment:
| Q |
18 |
acttgcatgtatgatgatgcttccattgcatttgcatgaaggagacaagacattgaaaagaagatgcatggcaaaaaggatcagatcacccgatgaaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
6461496 |
acttgcatgtatgatgatgcttccattgcatttgcatgaaggagacaagacattgaaaagaagatgcatggcaaaaaggatcag---acccggtgaaatc |
6461592 |
T |
 |
| Q |
118 |
taataaattttt |
129 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6461593 |
taataaattttt |
6461604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 181 - 243
Target Start/End: Complemental strand, 6465493 - 6465434
Alignment:
| Q |
181 |
tgttaagaatctcatataccttatgcagaatacttctaacttttttgaagataagtaacttta |
243 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
6465493 |
tgttaagaatttcatataccttatgcagaatacttctaac---tttgaagagaagtaacttta |
6465434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University