View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2683_low_24 (Length: 340)

Name: NF2683_low_24
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2683_low_24
NF2683_low_24
[»] chr1 (2 HSPs)
chr1 (18-129)||(6461496-6461604)
chr1 (181-243)||(6465434-6465493)


Alignment Details
Target: chr1 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 18 - 129
Target Start/End: Original strand, 6461496 - 6461604
Alignment:
18 acttgcatgtatgatgatgcttccattgcatttgcatgaaggagacaagacattgaaaagaagatgcatggcaaaaaggatcagatcacccgatgaaatc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||||| |||||||    
6461496 acttgcatgtatgatgatgcttccattgcatttgcatgaaggagacaagacattgaaaagaagatgcatggcaaaaaggatcag---acccggtgaaatc 6461592  T
118 taataaattttt 129  Q
    ||||||||||||    
6461593 taataaattttt 6461604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 181 - 243
Target Start/End: Complemental strand, 6465493 - 6465434
Alignment:
181 tgttaagaatctcatataccttatgcagaatacttctaacttttttgaagataagtaacttta 243  Q
    |||||||||| |||||||||||||||||||||||||||||   |||||||| |||||||||||    
6465493 tgttaagaatttcatataccttatgcagaatacttctaac---tttgaagagaagtaacttta 6465434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University