View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_26 (Length: 329)
Name: NF2683_low_26
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 32874757 - 32874508
Alignment:
| Q |
1 |
gcagatttcttctgtatctaaaacgtgacaaaaaacttatagcaattttgtcattatactcatatgattgattaaacataattgaccatgtttgtggcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874757 |
gcagatttcttctgtatctaaaacgtgacaaaaaacttatagcaattttgtcattatactcatatgattgattaaacataattgaccatgtttgtggcta |
32874658 |
T |
|
| Q |
101 |
gtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattttgagcgtttctgggagaaccacgtaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32874657 |
gtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattttgagcgtttctgggagaacgacgtaata |
32874558 |
T |
|
| Q |
201 |
tctaccagatagtggtgccaagaaatttgtaaaatggaggcaacctacac |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32874557 |
tctaccagatagtggtgtcaagaaatttgtaaaatggaggcaacctacac |
32874508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 320
Target Start/End: Complemental strand, 32874478 - 32874438
Alignment:
| Q |
280 |
tattttactttattattgtatatgattgaacctattcatct |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874478 |
tattttactttattattgtatatgattgaacctattcatct |
32874438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University