View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_27 (Length: 316)
Name: NF2683_low_27
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 36537167 - 36537341
Alignment:
| Q |
1 |
tggccacatacattgttatctttgtagtaaaagcgatcaaggattagaagtgagtttgttttggtggagaaaagaaagtgttttggagcttcaactactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537167 |
tggccacatacattgttatctttgtagtaaaagcgatcaaggattagaagtgagtttgttttggtggagaaaagaaagtgttttggagcttcaactactt |
36537266 |
T |
 |
| Q |
101 |
ttttgatcaatgacttgaaacggctttgaaatgacttcatggatgattcgttttcttgtgtcaatgaggtagtag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537267 |
ttttgatcaatgacttgaaacggctttgaaatgacttcatggatgattcgttttcttgtgtcaatgaggtagtag |
36537341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 170 - 284
Target Start/End: Original strand, 36537410 - 36537524
Alignment:
| Q |
170 |
tagtagagttttatgtattgaatttgagtagttttggtagtcttggaacgtgagagtggaacggttagttaacggaatgagctcattggtggaagtggaa |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537410 |
tagtagagttttatgtattgaatttgagtagttttggtagtcttggaacgtgagagtggaacggttagttaacggaatgagctcattggtggaagtggaa |
36537509 |
T |
 |
| Q |
270 |
cggtttctaagaaat |
284 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36537510 |
cggtttctaagaaat |
36537524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University