View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_31 (Length: 291)
Name: NF2683_low_31
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 14 - 274
Target Start/End: Original strand, 40606795 - 40607055
Alignment:
| Q |
14 |
gaatcacgtgctgggaagcgtttgagcaaattacattttattgtgtctcataattgttgtgtcttaaatcagcaaggtttctaaacctggagccctctaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606795 |
gaatcacgtgctgggaagcgtttgagcaaattacattttattgtgtctcataattgttgtgtcttaaatcagcaaggtttctaaacctggagccctctaa |
40606894 |
T |
 |
| Q |
114 |
attaatgccgagagtctattgcaaaggcccacagcagggctcatcattagccatgtggtaagaagttctggtactannnnnnnaaagaagtaaaaacaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
40606895 |
attaatgccgagagtctattgcaaaggcccacagcagggctcatcattagccatgtggtatgaagttctggtactatttttttaaagaagtaaaaacaag |
40606994 |
T |
 |
| Q |
214 |
tttattagaatgaataacgacgatagtccaacacattttattaggtgacaaatttaaattc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606995 |
tttattagaatgaataacgacgatagtccaacacattttattaggtgacaaatttaaattc |
40607055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University