View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_33 (Length: 278)
Name: NF2683_low_33
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 17 - 182
Target Start/End: Complemental strand, 30194154 - 30193989
Alignment:
| Q |
17 |
acatttgtagcctagcattacgctggttgtaagagtaatgtttgtgattattaaaactactagcagaagaagaattagctgcatagttaacaaccaaaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30194154 |
acatttgtagcctagcattacgctggttgtaagagtaatgtttgtgattattaaaactactagcagaagaagaattagctgcatagttaacaaccaaaat |
30194055 |
T |
|
| Q |
117 |
atatcttagagctctctcatcacgaatgggactgttgtctcaagtatgtccacaaaaacgataagc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30194054 |
atatcttagagctctctcatcacgaatgggactgttgtctcaagtatgtccacaaaaacgataagc |
30193989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 183 - 257
Target Start/End: Complemental strand, 30193956 - 30193882
Alignment:
| Q |
183 |
gtggttgttgttttgctccaaagcattgtgagtagtaggatgaatcgatcaaaaaagtcttggtggatagaagag |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193956 |
gtggttgttgttttgctccaaagcattgtgagtagtaggatgaatcgatcaaaaaagtcttggtggatagaagag |
30193882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 58 - 156
Target Start/End: Complemental strand, 30193624 - 30193526
Alignment:
| Q |
58 |
ttgtgattattaaaactactagcagaagaagaattagctgcatagttaacaaccaaaatatatcttagagctctctcatcacgaatgggactgttgtct |
156 |
Q |
| |
|
|||||||||||||||| | | || ||||| |||||| |||||| |||| ||||| ||||||||||||| |||| |||||| ||| ||||||||||| |
|
|
| T |
30193624 |
ttgtgattattaaaaccatgaacataagaataattagttgcataattaataaccaccatatatcttagaggtctcacatcacaaataagactgttgtct |
30193526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University