View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2683_low_38 (Length: 252)

Name: NF2683_low_38
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2683_low_38
NF2683_low_38
[»] chr7 (2 HSPs)
chr7 (175-252)||(17859508-17859585)
chr7 (18-59)||(17859350-17859391)
[»] chr4 (2 HSPs)
chr4 (175-252)||(4968039-4968116)
chr4 (18-59)||(4967881-4967922)
[»] chr5 (2 HSPs)
chr5 (175-252)||(34916227-34916304)
chr5 (18-59)||(34916421-34916462)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 17859508 - 17859585
Alignment:
175 cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgct 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
17859508 cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgct 17859585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 17859350 - 17859391
Alignment:
18 atgcactaagcaaagtcattaatcattatgattaatgacacc 59  Q
    ||||||||||||||||||||||||||||||||||||||||||    
17859350 atgcactaagcaaagtcattaatcattatgattaatgacacc 17859391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 4968039 - 4968116
Alignment:
175 cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgct 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4968039 cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgct 4968116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 4967881 - 4967922
Alignment:
18 atgcactaagcaaagtcattaatcattatgattaatgacacc 59  Q
    ||||||||||||||||||||||||||||||||||||||||||    
4967881 atgcactaagcaaagtcattaatcattatgattaatgacacc 4967922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 175 - 252
Target Start/End: Complemental strand, 34916304 - 34916227
Alignment:
175 cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgct 252  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
34916304 cactaacattagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgct 34916227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 34916462 - 34916421
Alignment:
18 atgcactaagcaaagtcattaatcattatgattaatgacacc 59  Q
    ||||||||||||||||||||||||||||||||||||||||||    
34916462 atgcactaagcaaagtcattaatcattatgattaatgacacc 34916421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University