View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_38 (Length: 252)
Name: NF2683_low_38
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_38 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] chr4 (2 HSPs) |
| |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 17859508 - 17859585
Alignment:
| Q |
175 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17859508 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgct |
17859585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 17859350 - 17859391
Alignment:
| Q |
18 |
atgcactaagcaaagtcattaatcattatgattaatgacacc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17859350 |
atgcactaagcaaagtcattaatcattatgattaatgacacc |
17859391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 175 - 252
Target Start/End: Original strand, 4968039 - 4968116
Alignment:
| Q |
175 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4968039 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgct |
4968116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 4967881 - 4967922
Alignment:
| Q |
18 |
atgcactaagcaaagtcattaatcattatgattaatgacacc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4967881 |
atgcactaagcaaagtcattaatcattatgattaatgacacc |
4967922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 175 - 252
Target Start/End: Complemental strand, 34916304 - 34916227
Alignment:
| Q |
175 |
cactaacactagttttttcaatcacagctcattggctgtgattgagatgatgatgcatttccttgtacaacagctgct |
252 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34916304 |
cactaacattagttttttcaatcacagctcattggctgtgattgagatgatgatgcatctccttgtacaacagctgct |
34916227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 34916462 - 34916421
Alignment:
| Q |
18 |
atgcactaagcaaagtcattaatcattatgattaatgacacc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34916462 |
atgcactaagcaaagtcattaatcattatgattaatgacacc |
34916421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University