View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_42 (Length: 243)
Name: NF2683_low_42
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_42 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 123 - 243
Target Start/End: Original strand, 4647648 - 4647768
Alignment:
| Q |
123 |
tgaatgagttttatacattgttctttcaatctcgttggaaagatatgttatcttgtgaagacagatgcatttatctaaagactacaaaagattttagaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4647648 |
tgaatgagttttatacattgttctttcaatctcgttggaaagatatgttatcttgtgaagacagatgcatttatctaaagactacaaaagattttagaag |
4647747 |
T |
 |
| Q |
223 |
ttgttgacactactagaaaaa |
243 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4647748 |
ttgttgacactactagaaaaa |
4647768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University