View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2683_low_49 (Length: 239)
Name: NF2683_low_49
Description: NF2683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2683_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 96 - 223
Target Start/End: Complemental strand, 972957 - 972830
Alignment:
| Q |
96 |
gtaatgctatggaataatgatgtaattctgaatattcataatcataatacaagatacattgattgttatattgtctgtccttttactcattttgaatggt |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972957 |
gtaatgctctggaataatgatgtaattctaaatattcataatcataatacaagatacattgattgttatattgtctgtccttttactcattttgaatggt |
972858 |
T |
 |
| Q |
196 |
atgctactggtttctatggcttttcaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
972857 |
atgctactggtttctatggcttttcaat |
972830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 107 - 222
Target Start/End: Complemental strand, 43137657 - 43137542
Alignment:
| Q |
107 |
gaataatgatgtaattctgaatattcataatcataatacaagatacattgattgttatattgtctgtccttttactcattttgaatggtatgctactggt |
206 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||| | || ||||||||| |||||||| ||| || ||||| | ||||||||||||||||| | | |
|
|
| T |
43137657 |
gaataatgatgtacacctaaatattctaaatcataataacatattcattgattgctatattgtttgtgctattactaactttgaatggtatgctaccgat |
43137558 |
T |
 |
| Q |
207 |
ttctatggcttttcaa |
222 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
43137557 |
ttctatggtttttcaa |
43137542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University