View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2684_low_3 (Length: 290)
Name: NF2684_low_3
Description: NF2684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2684_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 42674601 - 42674329
Alignment:
| Q |
19 |
gtgtgcttcttttatacaatgttgacaagaaggattaatcatttgaacaggactaccccaccccatatggagggaacttgtgtgaaacataaaaaatgta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42674601 |
gtgtgcttcttttatacaatgttgacaagaaggattaatcatttgaacaggactaccccaccccatatggagggaacttgtgtgaaacataaaaagtgta |
42674502 |
T |
|
| Q |
119 |
tggctttcatctattttacattttcaataacaagc---------------------aactaatgaaaatttccctaatt--agttagtataacatacatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42674501 |
tggctttcatctattttacattttcaataacaagcaattaaataaaaagaaaacctaactaatgaaaatttccctaattagagttagtataacatacatt |
42674402 |
T |
|
| Q |
196 |
catacatacatattatagatctctgagtctttttagttctggcaaaatgacagaagcaagacttggtctatcc |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42674401 |
catacatacatattatagatctctgagtctttttagttctggcaaaatgacagaagcaagacttggtctatcc |
42674329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University