View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2685_low_5 (Length: 273)
Name: NF2685_low_5
Description: NF2685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2685_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 28 - 265
Target Start/End: Complemental strand, 52967824 - 52967587
Alignment:
| Q |
28 |
tataaatctcaatatgaatgnnnnnnnggatgaaagaaagtgtcttgtatgaaagtgtagagagtagatttgagccaaagatgacttgccggcatgctgc |
127 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52967824 |
tataaatctcaatataaatgtttttatggatgaaagaaagtgtcttgtatgaaagtgtggagagtagatttgagccaaagatgacttgccggcatgctgc |
52967725 |
T |
 |
| Q |
128 |
ctgaaaagcaagaagggtgttgttttgctggcagttgtcattggttcatgtttgctcttttcactctcatatcagactccaaaattgaacattttttcta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52967724 |
ctgaaaagcaagaagggtgttgttttgctggcagttgtcattggttcatgtttgctcttttcactctcatatcagactccaaaattgaacattttttcta |
52967625 |
T |
 |
| Q |
228 |
tgcttaacatttttcaacaaatttcacaagttcatctc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52967624 |
tgcttaacatttttcaacaaatttcacaagttcttctc |
52967587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 28 - 211
Target Start/End: Complemental strand, 52961867 - 52961684
Alignment:
| Q |
28 |
tataaatctcaatatgaatgnnnnnnnggatgaaagaaagtgtcttgtatgaaagtgtagagagtagatttgagccaaagatgacttgccggcatgctgc |
127 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52961867 |
tataaatctcaatataaatgtttttatggatgaaagaaagtgtcttgtatgaaagtgtagagagtagatttgagccaaagatgacttgccggcatgctgc |
52961768 |
T |
 |
| Q |
128 |
ctgaaaagcaagaagggtgttgttttgctggcagttgtcattggttcatgtttgctcttttcactctcatatcagactccaaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52961767 |
ctgaaaagcaagaagggtgttgttttgctggcagttgtcattggttcatgtttgctcttttcacgctcatatcagactccaaaa |
52961684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University