View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2686_low_16 (Length: 341)
Name: NF2686_low_16
Description: NF2686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2686_low_16 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 15 - 341
Target Start/End: Complemental strand, 4555943 - 4555617
Alignment:
| Q |
15 |
acctgtgcagtgctgtattcatcatccttttcaacaaatggatagcacacttgaatgtctcctttacctcccacaaagcggaatgcagttgcgaacaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4555943 |
acctgtgcagtgctgtattcatcatccttttcaacaaatggatagcacacttgaatgtctcctttacctcccacaaagcggaatgcagttgcgaacaaca |
4555844 |
T |
 |
| Q |
115 |
ttgccttctggttcacataaatatcaaatcagcaaagtagaagagtttgtagcttcaactacaagaaataacgctgaagttggttttataacgctcataa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4555843 |
ttgccttctggttcacataaatatcaaatcagcaaagtagaagaatttgtagcttcaactacaagaaataacgctgaagttggttttgtaacgctcataa |
4555744 |
T |
 |
| Q |
215 |
agtttgtaaagcaagcaagttactagcaatttttaatttattcattttaaatctgcgttttctgcggtcacaaagtcactgcagtcatgaaatcgacatt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4555743 |
agtttgtaaagcaagcaagttactagcaatttttaatttattcattttaagtctgcgttttctgcggtcacaaagtcactgcagtcatgaaatcgacatt |
4555644 |
T |
 |
| Q |
315 |
attgttaattagataaaaatcagacga |
341 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
4555643 |
attgttaattagataaagatcagacga |
4555617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University