View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2686_low_17 (Length: 334)
Name: NF2686_low_17
Description: NF2686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2686_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 208 - 315
Target Start/End: Original strand, 43086817 - 43086924
Alignment:
| Q |
208 |
gaattgttataaactctttacttgctgtagttttactttatattcaacttatataaaacatgaaatcaaatttcaagggctgggtacaaacaaacaagat |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43086817 |
gaattgttataaactctttacttgctgtagttttactttatattcaacttatataaaacatgaaatcaaatctcaagggctgggtacaaacaaacaagat |
43086916 |
T |
|
| Q |
308 |
gtgcactt |
315 |
Q |
| |
|
|||||||| |
|
|
| T |
43086917 |
gtgcactt |
43086924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University