View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2686_low_29 (Length: 234)
Name: NF2686_low_29
Description: NF2686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2686_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 111 - 222
Target Start/End: Original strand, 24426777 - 24426888
Alignment:
| Q |
111 |
gtggtcaaagttggatatgacaaaatgaagatttacccagaggaatttggattagttcgagcatagagatcaagaagcaaaatagcttcaacaaattcca |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24426777 |
gtggtcaatgttggatatgacaaaatgaagatgtacccagaggaatttggattagttcaagcatagagatcaagaagcaaaagagcttcaacaaattcca |
24426876 |
T |
 |
| Q |
211 |
taatcaagtaaa |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
24426877 |
taatcaagtaaa |
24426888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 24426574 - 24426660
Alignment:
| Q |
1 |
ttttagtcattcaagggtttaaatacttgtttcatttcatccactcatggtttgaattgtgtcgttagttcaccttcatttaattgc |
87 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24426574 |
ttttagccattcaagggtttaaatacttgtttcatttcatccactcatggtttgaattgtgttgttagttcaccttcatttaattgc |
24426660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University