View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2686_low_30 (Length: 217)
Name: NF2686_low_30
Description: NF2686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2686_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 16 - 198
Target Start/End: Original strand, 6461224 - 6461402
Alignment:
| Q |
16 |
caatatggaccaaaatgacaataaaaatatgtaagtttttgaccgtatataaccatgtatatatgatgtgtggtctatggttctttaatttagacaagtg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6461224 |
caatatggaccaaaatgacaataaaaatatgtaagtttttggccgtatataaccatgtat----gatgtgtggtctatggttctttaatttagacaagtg |
6461319 |
T |
 |
| Q |
116 |
tgtggcctctaaaactttctttggacaaacactggcacgacacctccaacataggttttacaaaccatgttgcaccagaaaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6461320 |
tgtggcctctaaaactttctttggacaaatacgggcacgacacctccaacataggttttacaaaccatgttgcaccagaaaat |
6461402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University