View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_103 (Length: 226)
Name: NF2687_high_103
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_103 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 4887330 - 4887410
Alignment:
| Q |
1 |
atgccatcgaacttgcacttacaagtgcattgaatcctgtctataaattttggcatattcacaaggttggaaaaaggatta |
81 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4887330 |
atgccatcgaacttgaacttacaagtgcattgaatcctgtctataaattatggcatattcacaaggttggaaaaaggatta |
4887410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 113 - 226
Target Start/End: Complemental strand, 4917627 - 4917514
Alignment:
| Q |
113 |
atgaagaattaactaacaagttgtataatcttcaacaagagaaaatgcgtttgatcatcttcgataacatatggaacaatgatacatgcgatactttaag |
212 |
Q |
| |
|
|||||||||| | || |||||||| || ||||||||||||||||| |||||||| |||| ||| ||||||||| ||| || || || |||| |||||| |
|
|
| T |
4917627 |
atgaagaattggcaaaaaagttgtacaaagttcaacaagagaaaatgtgtttgatcgtcttggatgacatatggagcaacgagacttgggatattttaag |
4917528 |
T |
|
| Q |
213 |
tccagcctttccat |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4917527 |
tccagcctttccat |
4917514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 72 - 123
Target Start/End: Original strand, 4887442 - 4887493
Alignment:
| Q |
72 |
aaaaggattacaaacatatggtttgactgcaacaagaggcaatgaagaatta |
123 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4887442 |
aaaaagattacaagcatatggtttgactgcaacaagaggcaatgaagaatta |
4887493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University