View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_106 (Length: 215)
Name: NF2687_high_106
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_106 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 13 - 198
Target Start/End: Original strand, 10261401 - 10261586
Alignment:
| Q |
13 |
gagatgaagagattctaagattgtttttgtgagaaagtgaagattgttgggttgggaatttgaaggataccaatgaagcgatttttgcaaagaccatgac |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10261401 |
gagaagaagagattctaagattgtttttgtgagaaagtgaagattgttgggttgggaatttgaaggataccaatgaagcgatttttgcaaagaccatgac |
10261500 |
T |
 |
| Q |
113 |
tttaagcgatttagagaaaacccagatggaaaattggggttttggttaagtggttgaagaaaaaatggcatttcgtgtgatgaatc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10261501 |
tttaagcgatttagagaaaacccagatggaaaattggggttttggttaagtggttgaagaaaaaatggcatttcgtgtgatgaatc |
10261586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University