View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_46 (Length: 349)
Name: NF2687_high_46
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 2303470 - 2303132
Alignment:
| Q |
1 |
tggttaaattccttatcaacttgggaatgtgaaatacacaagagtattggatcttagtcataatcacctcattggtgtcattccaagttcattagtattg |
100 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2303470 |
tggtgaaataccttatcaacttgggaatgtgaaatacacaagagtattggatcttagtcataatcacctcattggtaccattccaagttcattagtattg |
2303371 |
T |
 |
| Q |
101 |
ttgaggaacattgacttgtcctataattctcttgagggtaagattccttctagtctccaagatactgtcgcgccgaacgcgtttattggaaatgagtttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2303370 |
ttgaggaacattgacttgtcctataattctcttgagggtaagattccttctagtctccaagatactgccgcgccgaacgcgtttattggaaatgagtttt |
2303271 |
T |
 |
| Q |
201 |
tgtgcaaccaatttagatattcaactacttgttactcctctcctaccaaaacaaacactagactcaagactcatatgaagattttcattccactcatatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2303270 |
tgtgcaaccaatttagatattcaactacttgttactcctctcctaccaaaacaaacactagactcaagactcatatgaagattttcattccactcatatc |
2303171 |
T |
 |
| Q |
301 |
ttttcttgctcttctatgctctttgtatgtgttcctatg |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2303170 |
ttttcttgctcttctatgctctttgtatgtgttcctatg |
2303132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University