View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_52 (Length: 342)
Name: NF2687_high_52
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 18 - 327
Target Start/End: Complemental strand, 2264274 - 2263965
Alignment:
| Q |
18 |
gatttctttctctaatattcttaatttatttattccatttccgtccttccaaagttgttaataagggtagagaacctcccatggcctcaggtgcatggcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264274 |
gatttctttctctaatattcttaatttatttattccatttccgtccttccaaagttgttaataagggtagagaacctcccatggcctcaggtgcatggcc |
2264175 |
T |
|
| Q |
118 |
aatacttggtcacctcttagtcttaggtggttctaaaacacctcataaaacattaggcaccatggctaacaaatacggaccccttttcaccataaaactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
2264174 |
aatacttggtcacctcttagtcttaggtggttctaaaacacctcataaaacattaggcaccatggctaacaaatatggacccctattcaccataaaactt |
2264075 |
T |
|
| Q |
218 |
ggtacaaatcgtgctttggtactaagcaattgggaaatggcaaaagagtgttacactataaacgatgttgccgtttcgtctcgttctaaacttgttgcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2264074 |
ggtacaaatcgtgctttggtactaagcaattgggaaatggcaaaagagtgttacactataaacgatgttgccgtttcgtctcgttctaaacttgttgcaa |
2263975 |
T |
|
| Q |
318 |
ttgaacatat |
327 |
Q |
| |
|
|||||||||| |
|
|
| T |
2263974 |
ttgaacatat |
2263965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 106 - 134
Target Start/End: Original strand, 2305713 - 2305741
Alignment:
| Q |
106 |
aggtgcatggccaatacttggtcacctct |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2305713 |
aggtgcatggccaatacttggtcacctct |
2305741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University