View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_59 (Length: 310)
Name: NF2687_high_59
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_59 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 6 - 310
Target Start/End: Original strand, 10260923 - 10261227
Alignment:
| Q |
6 |
aggagcacagaagtactcttatgcgaatgcaccggtatctgcttcttcgcccacctaaccaacggcttcaacgcacccctcaaacctgacacattataaa |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10260923 |
aggaacacagaagtactcttatgcgaatgcaccggtatctgcttcttcgcccacctaaccaacggcttcaacgcacccctcaaacccgacacattataaa |
10261022 |
T |
|
| Q |
106 |
ctaacttatcaatccctggctccgtttccattcggtcataggcacgaccggttggcttcttcctatgcaagccatctctcaaagacttaactgctatagg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10261023 |
ctaacttatcaatccctggctccgtttccattcggtcataggcacgaccggttggcttcttcctatgcaagccatctctcaaagacttaactgctatagg |
10261122 |
T |
|
| Q |
206 |
aagactgctatgtctcttatattgaacataagcattataaacataaacacgagttccggtactaccgagatcaagaacaacatagtatttaccagaccca |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10261123 |
aagactgctatgtctcttatattgaacataagcattataaacataaacacgagttccggtactaccgcaatcaagaacaacatagtatttaccagaccca |
10261222 |
T |
|
| Q |
306 |
atatt |
310 |
Q |
| |
|
||||| |
|
|
| T |
10261223 |
atatt |
10261227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University