View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_72 (Length: 281)
Name: NF2687_high_72
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_72 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 32616243 - 32616058
Alignment:
| Q |
17 |
cctccaagtcaatgaaattgcagggattgtctaggaccagatttgtgaaacaagggnnnnnnnnttattgagtccaaaattttcatatatgttcaagaac |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616243 |
cctccaagtcaatgaaattgcagg-attgtctagcaccagatttgtgaaacaagggaaaaaaaattattgagtccaaaattttcatatatgttcaagaac |
32616145 |
T |
 |
| Q |
117 |
ctggtaaactcaaattttcgatttatggaatagaagaatagattttagattcaatccataattttagattcaaacgaagtgtaccaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616144 |
ctggtaaactcaaattttcgatttatagaatagaagaatagattttagattcaatccataattttagattcaaacgaagtgtaccaa |
32616058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University