View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_85 (Length: 245)
Name: NF2687_high_85
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 16 - 140
Target Start/End: Original strand, 30579940 - 30580065
Alignment:
| Q |
16 |
atccatttgtaccacatataataaaatgtacttcacaaatnnnnnnntgtcaactcataaaaagaaatatca-ttatttggatagattaatttttgtact |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30579940 |
atccatttgtaccacatataataaaatgtacttcacaaagaaaaaaatgtcaactcataaaaagaaatatcaattatttggatagattaatttttgtact |
30580039 |
T |
 |
| Q |
115 |
tgtttgcttgaaataccttaattaac |
140 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30580040 |
tgtttgcttgaaataccttaattaac |
30580065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 245
Target Start/End: Original strand, 30580115 - 30580153
Alignment:
| Q |
207 |
attgcatgataaaggtatgagaaatgatatttgtacaac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30580115 |
attgcatgataaaggtatgagaaatgatatttatacaac |
30580153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University