View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_88 (Length: 241)
Name: NF2687_high_88
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_88 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 38771983 - 38771887
Alignment:
| Q |
1 |
tcttttctgtttgtaaagtccaattttgagcttatacttatatcttataagttcttattatcaaaatagacatgtttggtcataattgagctattat |
97 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38771983 |
tcttttctgtttgtaaagtccaatttcgagcttatacttatatcttataagttcttattatcaaaatagacatgtttggtcataattgagctattat |
38771887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 222
Target Start/End: Complemental strand, 38771830 - 38771761
Alignment:
| Q |
154 |
tttaatcctctgatttatctataaccaaccaacttattagttatccgcta-cttttttaccaacccgtcc |
222 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
38771830 |
tttaatcctctagtttatctatgatcaaccaacttattagttatccgctagtttttttaccaaccggtcc |
38771761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University