View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_92 (Length: 239)
Name: NF2687_high_92
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 227
Target Start/End: Complemental strand, 4350522 - 4350316
Alignment:
| Q |
18 |
atatgtccccgacccaaactatgtttaacacaagataccttaattttattcatcttgannnnnnngcgattatatatctctctaaaaatggaactttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4350522 |
atatgtccccgacccaaactatgtttaacacaagataccttaattttattcatcttgatttttt-gcgattatatatctctctaaaaatggaactttcat |
4350424 |
T |
 |
| Q |
118 |
atttcttttgacaaattcacagaggatattaattttgccaataaactctaaacatatataa-aaaataaagtcctaacaaaattatcatgcatgtccatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4350423 |
atttcttttgacaaattcacagaggatattaattttgccaataaactctcaacatatataaaaaaataaag---taacaaaattatcatgcatgtccatg |
4350327 |
T |
 |
| Q |
217 |
atcttctccta |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
4350326 |
atcttctccta |
4350316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University