View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_high_95 (Length: 237)
Name: NF2687_high_95
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_high_95 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 51 - 221
Target Start/End: Complemental strand, 30172732 - 30172564
Alignment:
| Q |
51 |
gaattttagttaacaatttttagatatgaatttttta-aaattactccatattgtacgagtttagcatcttccacacaatacacaatcccaataggtcac |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
30172732 |
gaattttagttaacaatttttagagatgaattttttgtaaattactccatattgtacgagtttagc-tcttccaca--atacacaatcccaataggtcac |
30172636 |
T |
|
| Q |
150 |
taatagccggataaacatcctgaattgccactttgcatataaaatacaaatgacatttgatttagtggataa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30172635 |
taatagccggataaacatcctgaattgccactttgcatataaaatacaaatgacatttgatttagtggataa |
30172564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 30172777 - 30172744
Alignment:
| Q |
1 |
aatctgaaatttggcggaaagtaagcaaagtttg |
34 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
30172777 |
aatctgaaatttggcggaaagtaagcgaagtttg |
30172744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University