View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_100 (Length: 235)
Name: NF2687_low_100
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_100 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 98 - 222
Target Start/End: Original strand, 35524974 - 35525098
Alignment:
| Q |
98 |
gtcctccaattttaacttatctgatttttgccttaaagttgcatatgaagctttagattgatacaacatttatttctaagttttgataatgtgtgtctcg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35524974 |
gtcctccaattttaacttatctgatttttgccttaaagttgcatatgaagctttagattgatgcaacatttatttctaagttttgataatgtgtgtctcg |
35525073 |
T |
|
| Q |
198 |
tgaaaaatacagggattacgtgtct |
222 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
35525074 |
tgaaaaatacagggattatgtgtct |
35525098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 112 - 222
Target Start/End: Original strand, 35521411 - 35521520
Alignment:
| Q |
112 |
acttatctgatttttg-ccttaaagttgcatatgaagctttagattgatacaacatttatttctaagttttgataatgtgtgtctcgtgaaaaatacagg |
210 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35521411 |
acttatctgatttttttccttaaagtt--atatgaagctttagattgatgcaacatttatttctaagttttgataatgtgtgtcttgtgaaaaatacagg |
35521508 |
T |
|
| Q |
211 |
gattacgtgtct |
222 |
Q |
| |
|
|||| |||||| |
|
|
| T |
35521509 |
aattatgtgtct |
35521520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University