View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_52 (Length: 343)
Name: NF2687_low_52
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 52874752 - 52875083
Alignment:
| Q |
1 |
tcatctttgactaccttctatatgattagacatcaaccattgcaatcagctaactattaggccttagactagagttattattcaccaagcaagtcttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52874752 |
tcatctttgactaccttctatatgattagacatcaatcattgcaatcagctaactattaggtcttatactagagttattattcaccaagcaagtcttatt |
52874851 |
T |
|
| Q |
101 |
ctcatcttgtgttcacctagtttaatgattgcaagtttatttagttattttactactgaatcttaaaggatgttagtttatatatgtgtgtttctttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874852 |
ctcatcttgtgttcacctagtttaatgattgcaagtttatttagttattttactactgaatcttaaaggatgttagtttatatatgtgtgtttctttttt |
52874951 |
T |
|
| Q |
201 |
attttagggatcttccccggctgaaagagtgacaaatgattctgaaaacgaaattgttaacatagatacaaagggggctatcatctttgtcattacggct |
300 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874952 |
attttagggatcttccactgctgaaagagtgacaaatgattctgaaaacgaaattgttaacatagatacaaagggggctatcatctttgtcattacggct |
52875051 |
T |
|
| Q |
301 |
tctacgtttcttgtgctattatttttcttcat |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52875052 |
tctacgtttcttgtgctattatttttcttcat |
52875083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University