View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_54 (Length: 336)
Name: NF2687_low_54
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 36 - 316
Target Start/End: Complemental strand, 26425625 - 26425345
Alignment:
| Q |
36 |
atgaaccaagctttgccttattaaaataagatggaagattttgtgtggtgagaaggctttatggtgtgatgttatgcaaggtaagtattgccgtaatgtt |
135 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26425625 |
atgaaccaagctttgccttatgaaaataagatggaagattttgtgtggtgagaaggctttatggtgtgatgttatgcaaggtaagtattgccgtaatgat |
26425526 |
T |
 |
| Q |
136 |
acccatgatcttgataatgtcatagctaagtctaatgatttatgcttatggaaaaatttaactaagctttggcctaagttgaaggattttgagtatggac |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26425525 |
acccatgatcttgataatgtcatagctaagtctaatgatttatgcttatggaaaaatttaactaagctttggcctaagttgaaggattttgagtatggac |
26425426 |
T |
 |
| Q |
236 |
aaagtattcacgcatggaagcaatgttgggtggattgtggttttaaaattgcaaatttggatgtttgaggaatgtcatggt |
316 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26425425 |
aaagtattcacgcatggaaacaatgttgggtggattgtggttttaaaattgtaaatttggatgtttgaggaatgtcatggt |
26425345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University