View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_57 (Length: 315)
Name: NF2687_low_57
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 12 - 294
Target Start/End: Complemental strand, 41094381 - 41094099
Alignment:
| Q |
12 |
catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094381 |
catcatcagtttcattggtttgaaacggagtaacgaaatcagggttagggttagggcttgaaactccgaatccatatccgggaggagaatgttggtcatt |
41094282 |
T |
 |
| Q |
112 |
gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094281 |
gttgatgttgttgctggtgtcaacggtgaggtgatcgtcgtcgggattatttggaggatggaatgtggatccataatcaaactgctgttgagaattgaat |
41094182 |
T |
 |
| Q |
212 |
ccttcatagttactattattgtcatcttcaaaaggtcctcctactactactcctcctcctccaccagtggttggagattgatg |
294 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41094181 |
ccttcatagttactattgttgtcatcttcaaaaggtcctcctactactactcctcctcctccaccagtggttggagattgatg |
41094099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University