View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_81 (Length: 255)
Name: NF2687_low_81
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_81 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40547577 - 40547350
Alignment:
| Q |
1 |
tgatcaagaattgtttccatcaagaatcgaattcggtttctcttgaccgattcgtcataagagaaactcattatcacttggttcaattaatatataatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40547577 |
tgatcaagaattgtttccatcaagaatcgaattcggtttctcttgaccgattcatcaaaagagaaactcattatcacttggttcaattaatatataatct |
40547478 |
T |
|
| Q |
101 |
gtgcnnnnnnnnnnnnnnnnnnaccttggcttgtataatttgtataggaaatactttagacgagttggattttgaaaaatttatcggaattaaagaaagt |
200 |
Q |
| |
|
|||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40547477 |
gtgcttttttttttt-------accttgacttgtataatttgtatacgaaatactttagacgagttggattttgaaaaatttatcggaattaaagaaagt |
40547385 |
T |
|
| Q |
201 |
ctcaagatttagccaatatttatttatagaaataa |
235 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||| |
|
|
| T |
40547384 |
ctgaaaatttagccaatatttatttatagaaataa |
40547350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 53
Target Start/End: Complemental strand, 33179497 - 33179449
Alignment:
| Q |
5 |
caagaattgtttccatcaagaatcgaattcggtttctcttgaccgattc |
53 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| ||||| ||| |||||| |
|
|
| T |
33179497 |
caagaattgtttccatcaggaatcgaactcggcttctcctgaacgattc |
33179449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University