View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_84 (Length: 250)
Name: NF2687_low_84
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_84 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 32460076 - 32459836
Alignment:
| Q |
1 |
tctcgattagatgtggtcaaaataccttacaaacaacacatttcgaccaatgaattaagattagactgttattattacgaatcaaaacatttgaaatat- |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32460076 |
tctcgattagatgtggtcaaaataccttacagacaacacatctcgaccaatgaattaagattagactgttattattacgaatcaaaacatttgaaatatt |
32459977 |
T |
 |
| Q |
100 |
ggtttgatgaaatcgaaatatgacatatctaatcttaattcaaccgttgtgatctcaaaatgaaattactgtacgatattttgactacagacaatctaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
32459976 |
ggtttgatgaaatcgaaatatgacatatctaatcttaattcaaccgttgggatctcaaaatgaaattattgtacgatattttgactacagacgatctaaa |
32459877 |
T |
 |
| Q |
200 |
ttcatattgatcattgaaatttataggttatgctccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32459876 |
ttcatattgatcattgaaatttatagattatgctccctatg |
32459836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University