View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2687_low_99 (Length: 236)
Name: NF2687_low_99
Description: NF2687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2687_low_99 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 51826787 - 51827012
Alignment:
| Q |
11 |
cataggaaattatcaaagaggtaatcttttttctaacaggtccaacgatgcatggaaggagcactccaatctcaagtggaagaacaactttgctctaaat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
51826787 |
cataggaaattatcaaagaggtaatcttttttctaacacgtccaacgatgcacggaaggagcactctaatcgcaagtggaaaaacaactttgctctaaat |
51826886 |
T |
 |
| Q |
111 |
cccactcaagggccgccacaaaatccataacaaacaaagatggctcaacaggaagaaatgttgaaacaactcatgaaggccacccgtattagctagcatt |
210 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
51826887 |
cccactcaagggccaccacaaaatccataacaaacaaagatggctcaacaggaagaaatgttgaaacaactcatgaagtccacccatattagctagcatt |
51826986 |
T |
 |
| Q |
211 |
caagagatgaagctgaaaaggaaacc |
236 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
51826987 |
caagagatgaagttgaaaaggaaacc |
51827012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University