View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2688_low_10 (Length: 255)
Name: NF2688_low_10
Description: NF2688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2688_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 30 - 200
Target Start/End: Original strand, 31111803 - 31111973
Alignment:
| Q |
30 |
agaatgcgtgtctcgctcaagtagaagaaaatcaatataaaatttctgctgcaaatgtgacttaaattaaggtcgttcaacgaaatcaacaaaccgccac |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111803 |
agaatgcgtgtctcactcaagtagaagaaaatcaatataaaatttctgctgcaaatgtgacttaaattaaggtcgttcaacgaaatcaacaaaccgccac |
31111902 |
T |
|
| Q |
130 |
tccaatgaatgtggtagaaaatgttgcttctgagaaagatgaaaatcaggatccatggcacaaagttcctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31111903 |
tccaatgaatgtggtagaaaatgttgcttctgagaaagatgaaaatcaggatccatggcacaaagttcctt |
31111973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University