View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2688_low_13 (Length: 201)
Name: NF2688_low_13
Description: NF2688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2688_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 47443638 - 47443795
Alignment:
| Q |
18 |
aaaacagaaattaaaccattaaacaacaaattagtgatggaatggcggcagatcaaaacaaaaaacaaaggcggtatcacggccaagatcgaaatcgcag |
117 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47443638 |
aaaatagaaattgaaccattaaacaacaaattagtgatggaatggc---agatcaaaacaaaaaacaaaggtggtatcacggccaagatcgaaatcgcag |
47443734 |
T |
 |
| Q |
118 |
acagtaacaaaaacggaaacaagaacgaaacttgaatcgcaatgttggatcaagttaaata |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
47443735 |
acagtaacaaaaacggaaacaagaacgaaacttgaatcgcaatgttagatcaagttgaata |
47443795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University