View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2690_high_6 (Length: 313)
Name: NF2690_high_6
Description: NF2690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2690_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 299
Target Start/End: Complemental strand, 6971592 - 6971312
Alignment:
| Q |
18 |
ataatgacagcaaatgaatcnnnnnnntaataacccagaggagtacaaatttggtttatttacatgaagaagttaaggttttctattgggaaatacttga |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6971592 |
ataatgacagcaaatgaatcaaaataataataacccagaggagtacaaatttggtttatttacatgaagaagttaaggttttctattgggaaatacttga |
6971493 |
T |
 |
| Q |
118 |
tgttgctattaagtaatttcatgaaaataaacgaatgactctaattgactgcttttataatgcacacctgcatgatttccatcaaacatggaagataacg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6971492 |
tgttgctattaagtaatttcatgaaaataaacgaatgactctaattgactgcttttat-atgcacacctgcatgatttccatcaaacatggaagataacg |
6971394 |
T |
 |
| Q |
218 |
cctatgtttggaaccacgtttctcagccgagtcaccacatgtccaagtcaagcctattgaagctattcatcccgtgtctgtg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
6971393 |
cctatgtttggaaccacgtttctcagccgagtcaccacatgtccaagtcaaacctatcgaagctattcatcccgtgtctgtg |
6971312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University