View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2690_low_10 (Length: 253)

Name: NF2690_low_10
Description: NF2690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2690_low_10
NF2690_low_10
[»] chr1 (1 HSPs)
chr1 (13-253)||(6936873-6937114)


Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 13 - 253
Target Start/End: Original strand, 6936873 - 6937114
Alignment:
13 aatatagtcaattagtcat-aacttcatacctagtaatttgtattatccacaaaaattgcatggtaaaagaaataagcatatcccatgatagtgaaaatt 111  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6936873 aatatagtcaattagtcattaacttcatacctagtaatttgtattatccacaaaaattgcatggtaaaagaaataagcatatcccatgatagtgaaaatt 6936972  T
112 atgatatccctaatagaccagatggaatattcaccaaattagtgcatgtttggattgacaatgaggtctgacatgattacagtgtgccaccgtgattttg 211  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
6936973 atgatatccctaatagaccaaatggaatattcaccaaattagtgcatgtttggattgacaatgaggtctgacatgattacattgtgccaccgtgattttg 6937072  T
212 taaaaagctagatgcttcaacaaaatcacgacatcactgtga 253  Q
    ||||||||||||||||||||||||||||||||||||||||||    
6937073 taaaaagctagatgcttcaacaaaatcacgacatcactgtga 6937114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University