View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2694_high_18 (Length: 225)
Name: NF2694_high_18
Description: NF2694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2694_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 42 - 182
Target Start/End: Original strand, 20135352 - 20135492
Alignment:
| Q |
42 |
ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatggtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20135352 |
ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatcgtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt |
20135451 |
T |
 |
| Q |
142 |
ggactacactcgtattctcattttgacgcctcaaattgaaa |
182 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
20135452 |
ggactacgctcgtattctcattttgatgcctcaaatagaaa |
20135492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 42 - 182
Target Start/End: Complemental strand, 44356719 - 44356579
Alignment:
| Q |
42 |
ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatggtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44356719 |
ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatcgtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt |
44356620 |
T |
 |
| Q |
142 |
ggactacactcgtattctcattttgacgcctcaaattgaaa |
182 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
44356619 |
ggactacgctcgtattctcattttgatgcctcaaatagaaa |
44356579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University