View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2694_low_15 (Length: 260)
Name: NF2694_low_15
Description: NF2694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2694_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 91 - 248
Target Start/End: Complemental strand, 34655833 - 34655676
Alignment:
| Q |
91 |
tgaataatctcacatcgacaaggaatgagataaatgaaagatatataagagatgtgatccatatactcgatgcctattgttgctcgatccatatactcga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34655833 |
tgaataatctcacatcgacaaggaatgagataaatcaaagatatataagagatgtgatccatatactcgatgcctattgttgctcgatccatatactcga |
34655734 |
T |
 |
| Q |
191 |
tgccttaagattttgggtggaaatgcagtgttcaggtcttttgcctattgttgctctc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34655733 |
tgccttaagattttgggtggaaatgcagtgttcaggtcttttgcctattgttgctctc |
34655676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 158
Target Start/End: Original strand, 26534676 - 26534720
Alignment:
| Q |
114 |
aatgagataaatgaaagatatataagagatgtgatccatatactc |
158 |
Q |
| |
|
||||||| ||||||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
26534676 |
aatgagaaaaatgaaggatatataagagaagtgatacatatactc |
26534720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University