View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2694_low_18 (Length: 238)
Name: NF2694_low_18
Description: NF2694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2694_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 69 - 222
Target Start/End: Complemental strand, 33078803 - 33078650
Alignment:
| Q |
69 |
gctctttaactaggttcttcaagggacaatttaacatgaaatattttattttaggannnnnnncatgacaatagaacctacgataacaaaatgaattcaa |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33078803 |
gctctttaactaggttcttcaagggacaatttaacattaaatattttattttaggatttttttcatgacaatagaacctacgataacaaaatgaattcaa |
33078704 |
T |
|
| Q |
169 |
agccttattgttaacaaatctttatactaaatgttagaaatcatatgtaacagc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33078703 |
agccttattgttaacaaatctttatactaaatgttagaaatcatatgtaacagc |
33078650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University