View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2694_low_21 (Length: 225)

Name: NF2694_low_21
Description: NF2694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2694_low_21
NF2694_low_21
[»] chr8 (1 HSPs)
chr8 (42-182)||(20135352-20135492)
[»] chr7 (1 HSPs)
chr7 (42-182)||(44356579-44356719)


Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 42 - 182
Target Start/End: Original strand, 20135352 - 20135492
Alignment:
42 ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatggtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
20135352 ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatcgtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt 20135451  T
142 ggactacactcgtattctcattttgacgcctcaaattgaaa 182  Q
    ||||||| |||||||||||||||||| ||||||||| ||||    
20135452 ggactacgctcgtattctcattttgatgcctcaaatagaaa 20135492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 42 - 182
Target Start/End: Complemental strand, 44356719 - 44356579
Alignment:
42 ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatggtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
44356719 ttcccatacatgcttggaatgatgatttcttcaggatgtgtgtgaatcgtgttggacggtttattcatttagatgaatgtacggcggatagagcgaggtt 44356620  T
142 ggactacactcgtattctcattttgacgcctcaaattgaaa 182  Q
    ||||||| |||||||||||||||||| ||||||||| ||||    
44356619 ggactacgctcgtattctcattttgatgcctcaaatagaaa 44356579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University