View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2695_high_2 (Length: 652)
Name: NF2695_high_2
Description: NF2695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2695_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 3e-53
Query Start/End: Original strand, 20 - 162
Target Start/End: Complemental strand, 18983770 - 18983628
Alignment:
| Q |
20 |
ctgatgatgctgctgcatttgatttcaacgaccccaatgcaatgttggtgctattactgcataacttccaggccaagttggaaaatactttcaatggaac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| || |||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18983770 |
ctgatgatgctgctgcatttgatttcaacgaccccaatgcaatgttgctgccattactgcaaaatttcctggccaagttggaaaatacttgcaatggaac |
18983671 |
T |
 |
| Q |
120 |
ttcttttttaatgtttaccaaatccttttcctgcagagtaata |
162 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
18983670 |
ttcttttttaatgtttaccaaacccttctcctgctgagtaata |
18983628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University