View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2695_low_13 (Length: 325)
Name: NF2695_low_13
Description: NF2695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2695_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 20 - 314
Target Start/End: Complemental strand, 44299453 - 44299159
Alignment:
| Q |
20 |
tttagttacaatcattttgtttctattagtaacattaccatttgcctcatgtgaatcagagtgctcgtccaaatatgaaggtgtatgtcacaacaaaaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44299453 |
tttagttacaatcattttgtttctattagtaacattaccatttgcctcatgtgaatcagagtgctcgtccaaatatgaaggtgtatgtcacaacaaaaat |
44299354 |
T |
 |
| Q |
120 |
gaagcactaaagctaaaattaattgcaatattttccatattagtgacgagcatgattggaatttgtattccaattttcacaacttcgatcccagcgttaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44299353 |
gaagcactaaagctaaaattaattgcaatattttccatattagtgacgagcatgattggaatttgtattccaattttcacaacttcgatcccagcattaa |
44299254 |
T |
 |
| Q |
220 |
aacccgacggagatttattcgtgatcgttaaggcttttgcctccggtgttatactcgctaccggttacatgcacgtgatgccagattcatttcag |
314 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44299253 |
aacccgacggagatttattcgtgatcattaaggcttttgcctccggtgttatactcgctaccggttacatgcacgtgatgccagattcatttcag |
44299159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University