View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2695_low_17 (Length: 253)
Name: NF2695_low_17
Description: NF2695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2695_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 43207201 - 43207427
Alignment:
| Q |
19 |
cactctacccgtttgaattttttaaacgtggtgttaattaattaactagataagttgaaattctgacactaacgtcgtgggagtttacaaggaaaccgga |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43207201 |
cactctacccgtttgaattttttaaacttggtgttaattaattaaccagataagttgaaattctgacacttacgtcgtgggagtttacaaggaaaccgga |
43207300 |
T |
 |
| Q |
119 |
cgtgccaaacagagctgcagattcaagttaatggaggcttatatataacatatgatatatctatgcttcagctttttgtaagagcataaaatcccgtttc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207301 |
cgtgccaaacagagctgcagattcaagttaatgcaggcttatatataacatatgatatatctatgcttcagctttttgtaagagcataaaatcccgtttc |
43207400 |
T |
 |
| Q |
219 |
aaagctgattagtgctaagcctttgct |
245 |
Q |
| |
|
||||||||||||| ||||||||||||| |
|
|
| T |
43207401 |
aaagctgattagtactaagcctttgct |
43207427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University