View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_43 (Length: 344)
Name: NF2696_high_43
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 19 - 333
Target Start/End: Original strand, 43712666 - 43712976
Alignment:
| Q |
19 |
ctacttacaagttcttgaatttgtatttaactagtagtaattgatgcataaacaaaaagtctcttcctagggtaagggtactactattactactaagatc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712666 |
ctacttacaagttcttgaatttgtatttaactagtagcaattgatgcataaacaaaaagtctcttcctagggtaagggtactactattactactaagatc |
43712765 |
T |
 |
| Q |
119 |
gtccaacactgatgtgatggcattttaggattcgaccccactacagcaatgctacctgagcaaattataacctgctgttgcatcaaattttccctttcat |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712766 |
gtcccacactgatgtgatggcattttaggattcgaccccactacagcaatgctacctaagcaaattataacctgctgttgcatcaaattttccctttccc |
43712865 |
T |
 |
| Q |
219 |
ctggctttcatcattcatgataaaatggtacattttcnnnnnnnnnnnnnnnaaattaaagttaattttgatattttggaccctttcttttctcttttat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43712866 |
ttggctttcatcattcatgataaaatggtacattttc----agagagagaaaaaattaaagttaattttgatattttggaccctttcttttctcttttat |
43712961 |
T |
 |
| Q |
319 |
caattcacctttcat |
333 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43712962 |
caattcacctttcat |
43712976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University