View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_47 (Length: 315)
Name: NF2696_high_47
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 215 - 292
Target Start/End: Complemental strand, 3688804 - 3688727
Alignment:
| Q |
215 |
ttcaccttcacgagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttcacttttcc |
292 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3688804 |
ttcaccttcaggagaagagctttgataatcagaaatagcagaagaacacctagaagacccattagatttgacttttcc |
3688727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 39 - 89
Target Start/End: Complemental strand, 3688983 - 3688933
Alignment:
| Q |
39 |
tcaacaatcaaacaaataccaagaaaatgtcataatttggtttttatattt |
89 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3688983 |
tcaacaaacaaacaaataccaagaaaatgtcataatttgatttttatattt |
3688933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University