View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_48 (Length: 315)
Name: NF2696_high_48
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 46 - 298
Target Start/End: Original strand, 39315102 - 39315353
Alignment:
| Q |
46 |
tctcattgataaatgatctacttgtaatgttgatgcttcattccgaagcagtgagtgaactggttaggacttgttgtagggaacataatggaaaaccaac |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39315102 |
tctcattgataaatgatctacttgtaatgttgatgcttcattccgaa-cagtgagtgaactggttaggacttgttgtagggaacataatggaaaaccaac |
39315200 |
T |
|
| Q |
146 |
catttctagtggggcttgactnnnnnnnnnnnnnnnnnnttgcagatttatcatcagatgctattgaagaattcttggaacatagccctattgggttgag |
245 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39315201 |
catttctagtggggcttgactcacactcacacacacacattgcagatttatcatcagatgctattgaagaattcttggaacataggcctattgggttgag |
39315300 |
T |
|
| Q |
246 |
atggtggcttaaacttgttgcttgggagtcaagactcctatggatcctttctg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39315301 |
atggtggcttaaacttgttgcttgggagtcaagactcctatggatcctttctg |
39315353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 185 - 290
Target Start/End: Complemental strand, 38139199 - 38139094
Alignment:
| Q |
185 |
ttgcagatttatcatcagatgctattgaagaattcttggaacatagccctattgggttgagatggtggcttaaacttgttgcttgggagtcaagactcct |
284 |
Q |
| |
|
||||| |||| || ||||||| | |||||||| ||||||| ||||| ||| ||| ||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
38139199 |
ttgcaaatttgtcttcagatgatgttgaagaactcttggagcataggcctgttgagttgagatggtggcttaaacttgttgcttgggagtcatggctcct |
38139100 |
T |
|
| Q |
285 |
atggat |
290 |
Q |
| |
|
|||||| |
|
|
| T |
38139099 |
atggat |
38139094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University