View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2696_high_59 (Length: 286)
Name: NF2696_high_59
Description: NF2696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2696_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 13 - 106
Target Start/End: Complemental strand, 45390234 - 45390141
Alignment:
| Q |
13 |
tgaagaactccgaggtaagtgtgaagggggtgtatgatccagcaatgttggttgaatatgtgtacaagagaattgggaagcatgcagtgatcat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45390234 |
tgaagaactccgaggtaagtgtgaagggggtgtatgatccagcaatgttggttgaatatgtgtacaagagaattgggaagcatgcagtgatcat |
45390141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 13 - 103
Target Start/End: Complemental strand, 45386083 - 45385993
Alignment:
| Q |
13 |
tgaagaactccgaggtaagtgtgaagggggtgtatgatccagcaatgttggttgaatatgtgtacaagagaattgggaagcatgcagtgat |
103 |
Q |
| |
|
|||||||||| |||||||| |||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45386083 |
tgaagaactctgaggtaagcgtgaagggagtgtatgattcagcaatgttggttgaatacatgtacaagagaattgggaagcatgcagtgat |
45385993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University